Neoverrucotoxin subunit alpha-like

Author: fxot

August undefined, 2024

WebAug 26, 2006 · A proteinaceous toxin with hemolytic and lethal activities, named neoverrucotoxin (neoVTX), was purified from the venom fluid of stonefish Synanceia verrucosa and its primary structure was elucidated by a cDNA cloning technique. NeoVTX is a dimeric 166 kDa protein composed of alpha-subunit (702 amino acid residues) and … WebApr 10, 2024 · Karyopherin subunit alpha 1 (KPNA1), also known as importin alpha 5 in human, is a cytoplasmic protein belonging to the importin alpha family and is involved in nuclear protein import [9, 10]. KPNA1 is ubiquitously expressed in brain, testis, and 25 other tissues, and the previous studies emphasized its effects on neuronal differentiation and …

UniProt

WebLegend. Settings. Analysis WebThe nonconventional α-neurotoxins, like candotoxin (from Bungarus candidus) (see Fig. 35-1C), are composed of 65 to 67 amino acids and target muscle with low and high affinity … townhouses for rent in destin florida

Purification, properties and cDNA cloning of neoverrucotoxin …

WebProtein target information for Neuronal acetylcholine receptor subunit alpha-7 (human). Find diseases associated with this biological target and compounds tested against it in … WebNext-day shipping cDNA ORF clones derived from LOC100706238 neoverrucotoxin subunit alpha-like available at GenScript, starting from $99.00. WebCHRNA9. Neuronal acetylcholine receptor subunit alpha-9, also known as nAChRα9, is a protein that in humans is encoded by the CHRNA9 gene. [5] The protein encoded by this gene is a subunit of certain nicotinic acetylcholine receptors (nAchR). α9 subunit-containing receptors are notably blocked by nicotine. The role of this antagonism in the ... townhouses for rent in denver colorado

LOC100706238 cDNA ORF clone, Oreochromis niloticus(Nile tilapia)

WebBackground and aims: NASH is an advanced stage of liver disease accompanied by lipid accumulation, inflammation, and liver fibrosis. Guanine nucleotide-binding protein G(i) subunit alpha-2 (GNAI2) is a member of the "inhibitory" class of α-subunits, and recent studies showed that Gnai2 deficiency is known to cause reduced weight in mice. WebOne toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests … townhouses for rent in edmond okWebCACNA2D1. Voltage-dependent calcium channel subunit alpha-2/delta-1 is a protein that in humans is encoded by the CACNA2D1 gene. [5] [6] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane ... townhouses for rent in eau claire wi

"WebNX_P52292 - KPNA2 - Importin subunit alpha-1 - Function. Functions in nuclear protein import as an adapter protein for nuclear receptor KPNB1. Binds specifically and directly to substrates containing either a simple or bipartite NLS motif. Docking of the importin/substrate complex to the nuclear pore complex (NPC) is mediated by KPNB1 … " - Neoverrucotoxin subunit alpha-like

Neoverrucotoxin subunit alpha-like

Webneoverrucotoxin subunit alpha-like CAAAGCCTGCTGTTCCTTGTG TGGTGCGGAAGGTGTAGAAGT caspase-1-like AACAAAGCAGACATGGCCCGT AGGGAATTCATCCGGTTCTCC type-2 ... XP_005453836.1 -13.4539 0.0062 0.487666 26S proteasome non-ATPase regulatory subunit 11B-like

Did you know?

WebSec61 alpha 1. Protein transport protein Sec61 subunit alpha isoform 1 is a protein that in humans is encoded by the SEC61A1 gene. [5] The protein encoded by this gene belongs to the SecY/Sec61α family. It plays a crucial role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. WebThe world's first wiki where authorship really matters. Due credit and reputation for authors [authorship tracking technology]. Imagine a global collaborative knowledge base for …

WebAug 29, 2014 · The best hit for this gene was a neoverrucotoxin subunit alpha-like gene of Oreochromis niloticus with E-value = 0.0 (Accession numbers of the hits were XP_003449498, XP_003449506, and XP_003449483). This gene was reported to be overexpressed in the brooding tissue of pregnant specimens of a species in genus … WebThe LOC101885938 CRISPR guide RNA sequences were designed by GenScript's proprietary algorithm to target a single locus in the endogenous genome. High-specificity …

WebProtein phosphatase 2 (PP2), also known as PP2A, is an enzyme that in humans is encoded by the PPP2CA gene. The PP2A heterotrimeric protein phosphatase is ubiquitously expressed, accounting for a large fraction of phosphatase activity in eukaryotic cells. Its serine/threonine phosphatase activity has a broad substrate specificity and … Webneoverrucotoxin subunit alpha-like Protein ID XP_005173831.1. Continue. For Enjoyable Protein Research NovoPro +86-21-61842887 86-213-536-6391 …

WebWikidata. View/Edit Human. View/Edit Mouse. Neuronal acetylcholine receptor subunit alpha-7, also known as nAChRα7, is a protein that in humans is encoded by the CHRNA7 gene. [5] The protein encoded by this gene is a subunit of certain nicotinic acetylcholine receptors (nAchR).

WebLegend. Settings. Analysis townhouses for rent in edison njWebAug 26, 2006 · A proteinaceous toxin with hemolytic and lethal activities, named neoverrucotoxin (neoVTX), was purified from the venom fluid of stonefish Synanceia … townhouses for rent in donelson tnWebα-Neurotoxins are a group of neurotoxic peptides found in the venom of snakes in the families Elapidae and Hydrophiidae. They can cause paralysis, respiratory failure, and … townhouses for rent in el paso txWebNADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 is a protein that in humans is encoded by the NDUFA1 gene. The NDUFA1 protein is a subunit of NADH … townhouses for rent in elizabeth city ncWebLegend. Settings. Analysis townhouses for rent in east hartford ctWebNeuronal acetylcholine receptor subunit alpha-1, also known as nAChRα1, is a protein that in humans is encoded by the CHRNA1 gene. The protein encoded by this gene is a subunit of certain nicotinic acetylcholine receptors (nAchR).. The muscle acetylcholine receptor consists of 5 subunits of 4 different types: 2 alpha isoforms and 1 each of beta, gamma, … townhouses for rent in fayetteville arWebSep 19, 2024 · Overexpression of Nrxn1α in αNrxn triple knock-out neurons is sufficient to restore normal presynaptic Ca 2+ influx and synaptic vesicle release. Moreover, … townhouses for rent in etobicoke